Display Settings:

Format

Send to:

Choose Destination
Pr012511962

STS probe PMC55343P2 for tRNA (TRNC) and 11 more genes

Synopsis

Field NameValues
NamePMC55343P2
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100288578; LOC100293593; MIR320D-1; TRNC; COX1; COX2; TRNA; TRND; TRNK; TRNN; TRNY; LOC643794
UniSTS IDUniSTS:273325

Sequences

>Probe|12511962|PRIMERF Forward PCR primer (outermost) (20b)
CCTGGAGCCTCCGTAGACCT
>Probe|12511962|PRIMERR Reverse PCR primer (outermost) (20b)
GCACTGCAGCAGATCATTTC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID273325
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk