Display Settings:

Format

Send to:

Choose Destination
Pr012511872

STS probe PMC351321P3 for bone gamma-carboxyglutamate (gla) protein (BGLAP) and 5 more genes

Synopsis

Field NameValues
NamePMC351321P3
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesBGLAP; BGLAP; BGLAP; LOC457388; BGLAP; BGLAP
UniSTS IDUniSTS:273244

Sequences

>Probe|12511872|PRIMERF Forward PCR primer (outermost) (20b)
GTGCAGAGTCCAGCAAAGGT
>Probe|12511872|PRIMERR Reverse PCR primer (outermost) (19b)
CGATAGGCCTCCTGAAAGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map1 cmPMC351321P3

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID273244
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk