Display Settings:

Format

Send to:

Choose Destination
Pr012511703

STS probe PMC31832P1 for adenosine monophosphate deaminase 3 (AMPD3) and 32 more genes

Synopsis

Field NameValues
NamePMC31832P1
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100299717; MTRNR2L8; Rnr2; Trnl1; Trni; Trnm; ND1; ND2; Rnr2; TrnI; TrnL1; TrnM; ND1; ND2More
UniSTS IDUniSTS:273091

Sequences

>Probe|12511703|PRIMERF Forward PCR primer (outermost) (23b)
TTTCGGTTGGGGCGACCTCGGAG
>Probe|12511703|PRIMERR Reverse PCR primer (outermost) (25b)
TTGCGCTGTTATCCCTAGGGTAACT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map11 cmPMC31832P1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID273091
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5504648
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk