Display Settings:

Format

Send to:

Choose Destination
Pr012511563

STS probe PMC316374P5 for dihydrofolate reductase (DHFR) and 15 more genes

Synopsis

Field NameValues
NamePMC316374P5
TypeSTS
Application
Source organism
Source sequence
Target genesMTRNR2L2; MTRNR2L12; Rnr2; Trnl1; DHFR; ND1; Rnr2; TrnL1; ND1; ND1; ND1; RNR2; TRNL1; RPL18AP8More
UniSTS IDUniSTS:272966

Sequences

>Probe|12511563|PRIMERF Forward PCR primer (outermost) (21b)
ACACACCGCCCGTCACCCTCC
>Probe|12511563|PRIMERR Reverse PCR primer (outermost) (23b)
GGCTGCTTTTAGGCCTACAATGG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5504610
UniSTS IDcontext specific help for: UniSTS ID272966
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk