Display Settings:

Format

Send to:

Choose Destination
Pr012510951

STS probe PMC289169P1 for N-acetylglucosamine-1-phosphate transferase, gamma subunit (GNPTG) and 5 more genes

Synopsis

Field NameValues
NamePMC289169P1
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesGNPTG; GNPTG; GNPTG; GNPTG; GNPTG; GNPTG
UniSTS IDUniSTS:272414

Sequences

>Probe|12510951|PRIMERF Forward PCR primer (outermost) (27b)
GTTCCACAACGTGACCCAGCACGAGCA
>Probe|12510951|PRIMERR Reverse PCR primer (outermost) (22b)
GTGATCAGCTCATCGGCCAGGT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map16 cmPMC289169P1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID272414
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk