Display Settings:

Format

Send to:

Choose Destination
Pr012510092

STS probe PMC17626P1 for similar to dentin sialophosphoprotein precursor (LOC471248)

Synopsis

Field NameValues
NamePMC17626P1
TypeSTS
Application
Source organism
Source sequence
Target geneLOC471248
UniSTS IDUniSTS:271640

Sequences

>Probe|12510092|PRIMERF Forward PCR primer (outermost) (20b)
GGCAGTGACTCAAAAGGAGC
>Probe|12510092|PRIMERR Reverse PCR primer (outermost) (20b)
TGCTGTCACTGTCACTGCTG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID271640
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk