Display Settings:

Format

Send to:

Choose Destination
Pr012509815

STS probe PMC156308P1 for parkin RBR E3 ubiquitin protein ligase (PARK2) and 1 more gene

Synopsis

Field NameValues
NamePMC156308P1
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPARK2; PARK2
UniSTS IDUniSTS:271391

Sequences

>Probe|12509815|PRIMERF Forward PCR primer (outermost) (23b)
ATGTTGCTATCACCATTTAAGGG
>Probe|12509815|PRIMERR Reverse PCR primer (outermost) (23b)
AGATTGGCAGCGCAGGCGGCATG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map6 cmPMC156308P1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID271391
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center