Display Settings:

Format

Send to:

Choose Destination
Pr012509704

STS probe PMC15407P1 for cytochrome P450, family 1, subfamily a, polypeptide 1 (Cyp1a1) and 1 more gene

Synopsis

Field NameValues
NamePMC15407P1
TypeSTS
Application
Source organism
Source sequence
Target genesCyp1a1; Cyp1a1
UniSTS IDUniSTS:271291

Sequences

>Probe|12509704|PRIMERF Forward PCR primer (outermost) (21b)
CAGATGATAAGGTCATCACGA
>Probe|12509704|PRIMERR Reverse PCR primer (outermost) (21b)
TTGGGGATATAGAAGCCATTC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5501201
UniSTS IDcontext specific help for: UniSTS ID271291
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk