Display Settings:

Format

Send to:

Choose Destination
Pr012509538

Eukaryota (5 taxa) STS probe PMC15121P1 for telomerase RNA component (TERC) and 7 more genes

Synopsis

Field NameValues
NamePMC15121P1
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Callithrix jacchus; Macaca mulatta; Pongo abelii; Homo sapiens
Target genesLOC100133738 (Homo sapiens); LOC100287726 (Homo sapiens); LOC100291718 (Homo sapiens); TERC (Callithrix jacchus); TERC (Macaca mulatta); LOC100442260 (Pongo abelii); LOC100593827 (Nomascus leucogenys); TERC (Homo sapiens)
UniSTS IDUniSTS:271141

Sequences

>Probe|12509538|PRIMERF Forward PCR primer (outermost) (26b)
TCTAACCCTAACTGAGAAGGGCGTAG
>Probe|12509538|PRIMERR Reverse PCR primer (outermost) (26b)
GTTTGCTCTAGAATGAACGGTGGAAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map3 cmPMC15121P1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID271141
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk