Display Settings:

Format

Send to:

Choose Destination
Pr012509219

STS probe PMC137792P1 for actin, beta (Actb) and 13 more genes

Synopsis

Field NameValues
NamePMC137792P1
TypeSTS
Application
Source organism
Source sequence
Target genesACTB; LOC100049792; ACTG1; ACTB; LOC100481987; actb; LOC100579675; LOC100584240; ACTB; ACTB; Actb; LOC100754446; ACTB; Actb
UniSTS IDUniSTS:270855

Sequences

>Probe|12509219|PRIMERF Forward PCR primer (outermost) (22b)
GACGAGGCCCAGAGCAAGAGAG
>Probe|12509219|PRIMERR Reverse PCR primer (outermost) (21b)
ACGTACATGGCTGGGGTGTTG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5031324
UniSTS IDcontext specific help for: UniSTS ID270855
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk