Display Settings:

Format

Send to:

Choose Destination
Pr012509153

STS probe PMC136359P1 for actin, beta (Actb) and 3 more genes

Synopsis

Field NameValues
NamePMC136359P1
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100443438; C1H1orf146; Actb; Actb
UniSTS IDUniSTS:270796

Sequences

>Probe|12509153|PRIMERF Forward PCR primer (outermost) (22b)
TGGAATCCTGTGGCATCCATGA
>Probe|12509153|PRIMERR Reverse PCR primer (outermost) (23b)
ATCTTCATGGTGCTAGGAGCCAG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5031316
UniSTS IDcontext specific help for: UniSTS ID270796
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk