Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012508721

Mus musculus STS probe PMC122623P2 for nitric oxide synthase 2, inducible (Nos2)

Synopsis

Field NameValues
NamePMC122623P2
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target geneNos2 (Mus musculus)

Sequences

>Probe|12508721|PRIMERF Forward PCR primer (outermost) (25b)
CACTTGGATCAGGAACCTGAAGCCC
>Probe|12508721|PRIMERR Reverse PCR primer (outermost) (25b)
CTTTGTGCTGGGAGTCATGGAGCCG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID270406
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk