Display Settings:

Format

Send to:

Choose Destination
Pr012508534

STS probe PMC112647P2 for family with sequence similarity 208, member A (FAM208A) and 1 more gene

Synopsis

Field NameValues
NamePMC112647P2
TypeSTS
Application
Source organism
Source sequence
Target genesFAM208A; MYO3B
UniSTS IDUniSTS:270238

Sequences

>Probe|12508534|PRIMERF Forward PCR primer (outermost) (21b)
CCTTCATTGACCTCAACTACA
>Probe|12508534|PRIMERR Reverse PCR primer (outermost) (21b)
GGCAGTGATGGCATGGACTGT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID270238
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk