Display Settings:

Format

Send to:

Choose Destination
Pr012508530

Mus musculus STS probe PMC112570P1 for interferon gamma (Ifng)

Synopsis

Field NameValues
NamePMC112570P1
AliasesPMC112810P1; PMC96694P1
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target geneIfng (Mus musculus)
UniSTS IDUniSTS:270234

Sequences

>Probe|12508530|PRIMERF Forward PCR primer (outermost) (25b)
AGAAGTAAGTGGAAGGGCCCAGAAG
>Probe|12508530|PRIMERR Reverse PCR primer (outermost) (25b)
AGGGAAACTGGGAGAGGAGAAATAT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID270234
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk