Display Settings:

Format

Send to:

Choose Destination
Pr012507244

STS probe UniSTS:269072 for Rho-related BTB domain containing 2 (RHOBTB2) and 17 more genes

Synopsis

Field NameValues
NameUniSTS:269072
AliasesMARC_26768-26769:1034174633:1
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesRHOBTB2; RHOBTB2; RHOBTB2; RHOBTB2; LOC100507119; RHOBTB2; RHOBTB2; Rhobtb2; RHOBTB2; Rhobtb2; RHOBTB2; LOC505083; LOC613985; RHOBTB2More
UniSTS IDUniSTS:269072

Sequences

>Probe|12507244|PRIMERF Forward PCR primer (outermost) (20b)
CCAGGAAGAGATGGCAGAAG
>Probe|12507244|PRIMERR Reverse PCR primer (outermost) (20b)
ACAGCTGGAAATCAACAGGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map8 cmUniSTS:269072

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID269072
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk