Display Settings:

Format

Send to:

Choose Destination
Pr012505900

STS probe MARC_15679-15680:1016555359:5 for cytochrome c-type heme lyase-like (LOC100524598)

Synopsis

Field NameValues
NameMARC_15679-15680:1016555359:5
TypeSTS
Application
Source organism
Source sequence
Target geneLOC100524598
UniSTS IDUniSTS:267863

Sequences

>Probe|12505900|PRIMERF Forward PCR primer (outermost) (20b)
GGAGGGAAGGCGAAAGAGTA
>Probe|12505900|PRIMERR Reverse PCR primer (outermost) (20b)
TGGTGAACTGGTAGTCCTGG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID267863
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk