Display Settings:

Format

Send to:

Choose Destination
Pr012504753

Homo sapiens STS probe D13S1654

Synopsis

Field NameValues
NameD13S1654
AliasesRH35203; SHGC-8760
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:26683

Sequences

>Probe|12504753|PRIMERF Forward PCR primer (outermost) (21b)
CAGGGCTACTTCTGTTTGCAG
>Probe|12504753|PRIMERR Reverse PCR primer (outermost) (21b)
GCTTCTGGAGTGATAGCGATG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3131577 cr10000SHGC-8760
Homo sapienslinkageRutgers Map13 cmD13S1654
Homo sapiensradiation hybridNCBI RH13520.2 crSHGC-8760

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID26683
Probe Cross-refcontext specific help for: Probe Cross-refGDB:740918
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk