Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012504434

Eukaryota (15 taxa) STS probe UniSTS:266542 for recombination activating gene 2 (RAG2) and 26 more genes

Synopsis

Field NameValues
NameUniSTS:266542
AliasesRAG2
TypeSTS
Application
Source organism
Source sequence
Target organismsCricetulus griseus; Mus musculus; Cavia porcellus; Anolis carolinensis; Nomascus leucogenys; Callithrix jacchus; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens; Ailuropoda melanoleuca; Felis catus; Equus caballus; Sus scrofa; Bos taurus; Oryctolagus cuniculus
Target genesRAG2 (Equus caballus); C12H11orf74 (Equus caballus); RAG2 (Sus scrofa); RAG2 (Oryctolagus cuniculus); LOC100336269 (Bos taurus); RAG2 (Callithrix jacchus); RAG2 (Pongo abelii); C11H11orf74 (Pongo abelii); LOC100483710 (Ailuropoda melanoleuca); LOC100484130 (Ailuropoda melanoleuca); rag2 (Anolis carolinensis); RAG2 (Nomascus leucogenys); C15H11orf74 (Nomascus leucogenys); Rag2 (Cavia porcellus); LOC100730321 (Cavia porcellus); Rag2 (Cricetulus griseus); LOC100754866 (Cricetulus griseus); C11orf74 (Homo sapiens); Rag2 (Mus musculus); RAG2 (Pan troglodytes); RAG2 (Homo sapiens); C15H11orf74 (Bos taurus); B230118H07Rik (Mus musculus); C14H11orf74 (Macaca mulatta); RAG2 (Macaca mulatta); C11H11orf74 (Pan troglodytes); RAG2 (Bos taurus)

Sequences

>Probe|12504434|PRIMERF Forward PCR primer (outermost) (21b)
TCATGGAGGGAAAACACCAAA
>Probe|12504434|PRIMERR Reverse PCR primer (outermost) (20b)
TGCACTGGAGACAGAGATTC

References

1.

A high-resolution cat radiation hybrid and integrated FISH mapping resource for phylogenomic studies across Felidae.

Davis BW, Raudsepp T, Pearks Wilkerson AJ, Agarwala R, Schäffer AA, Houck M, Chowdhary BP, Murphy WJ.

Genomics. 2009 Apr;93(4):299-304. doi: 10.1016/j.ygeno.2008.09.010. Epub 2008 Nov 5.

2.

Radiation hybrid mapping of 304 novel microsatellites in the domestic cat genome.

Menotti-Raymond M, David VA, Agarwala R, Schäffer AA, Stephens R, O'Brien SJ, Murphy WJ.

Cytogenet Genome Res. 2003;102(1-4):272-6.

Show All 3 References...

3.

Second-generation integrated genetic linkage/radiation hybrid maps of the domestic cat (Felis catus).

Menotti-Raymond M, David VA, Roelke ME, Chen ZQ, Menotti KA, Sun S, Schäffer AA, Tomlin JF, Agarwala R, O'Brien SJ, Murphy WJ.

J Hered. 2003 Jan-Feb;94(1):95-106. J Hered. 2003 Nov-Dec;94(6):following table of contents.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map11 cmUniSTS:266542
Felis catusradiation hybridRHD1946.1..967.5 crRAG2

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID266542
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk