Display Settings:

Format

Send to:

Choose Destination
Pr012503742

STS probe WI-2834 for cytochrome P450 family 19 subfamily A member 1 (CYP19A1) and 7 more genes

Synopsis

Field NameValues
NameWI-2834
AliasesHHAD10E7; MR2895; RH3927; RH54143
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100288810; LOC100290917; LOC100589061; LOC100589961; CYP19A1; CYP19A1; CYP19A1; LOC745692
UniSTS IDUniSTS:26592

Sequences

>Probe|12503742|PRIMERF Forward PCR primer (outermost) (20b)
CAGGCTCCAGGTTCTCATCT
>Probe|12503742|PRIMERR Reverse PCR primer (outermost) (18b)
TGCCAAACTGCAAGACCC

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map15 cmWI-2834
Homo sapiensradiation hybridNCBI RH15258.5 crWI-2834
Homo sapiensradiation hybridWhitehead-RH15147.9 cr3000WI-2834

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID26592
Probe Cross-refcontext specific help for: Probe Cross-refGDB:372400
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk