Display Settings:

Format

Send to:

Choose Destination
Pr012502265

STS probe D11S899 for neuron navigator 2 (NAV2)

Synopsis

Field NameValues
NameD11S899
Aliases022TH2; AFM022th2; HS022TH2; RH15002; RH9386
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneNAV2
UniSTS IDUniSTS:26459

Sequences

>Probe|12502265|PRIMERF Forward PCR primer (outermost) (20b)
CAGGAGGCAGACACAAGGAC
>Probe|12502265|PRIMERR Reverse PCR primer (outermost) (20b)
GAATTGGATTCTCTGGGGAG

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

Show All 3 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map11 cmD11S899
Homo sapienslinkageMarshfield1123.12 cmAFM022th2
Homo sapienslinkagedeCODE1129.35 cmD11S899
Homo sapienslinkageGenethon1126.5 cmAFM022th2

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID26459
Probe Cross-refcontext specific help for: Probe Cross-refGDB:187830
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk