Display Settings:

Format

Send to:

Choose Destination
Pr012501210

STS probe D20S96 for hypothetical protein LOC100287002 (LOC100287002)

Synopsis

Field NameValues
NameD20S96
AliasesAFM029yc3; RH233; RH96369; SHGC-658
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneLOC100287002
UniSTS IDUniSTS:26364

Sequences

>Probe|12501210|PRIMERF Forward PCR primer (outermost) (22b)
CAGGAAATGCAGCATACAGGAG
>Probe|12501210|PRIMERR Reverse PCR primer (outermost) (20b)
CTGGAGAGTTTCCCAGTCTT

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3202191 cr10000SHGC-658
Homo sapiensradiation hybridGeneMap99-G3202224 cr10000AFM029yc3
Homo sapienslinkageRutgers Map20 cmD20S96

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID26364
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk