Display Settings:

Format

Send to:

Choose Destination
Pr012499623

STS probe D16S744 for hypothetical protein LOC746496 (LOC746496)

Synopsis

Field NameValues
NameD16S744
AliasesD16S777; MH1248; RH34725; RH85267; SHGC-60705; SHGC-6485; SX_47_36.SEQ; WI-1256
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneLOC746496
UniSTS IDUniSTS:26221

Sequences

>Probe|12499623|PRIMERF Forward PCR primer (outermost) (20b)
CAGCCTGTTTTCCTCATCTG
>Probe|12499623|PRIMERR Reverse PCR primer (outermost) (20b)
TCAGCACGGTGTGTCCTATA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3161873 cr10000SHGC-6485
Homo sapienslinkageRutgers Map16 cmD16S744
Homo sapiensradiation hybridNCBI RH16382.4 crSHGC-6485

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID26221
Probe Cross-refcontext specific help for: Probe Cross-refGDB:355306
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk