Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012498201

Eukaryota (3 taxa) STS probe D18S1162 for formin homology 2 domain containing 3 (FHOD3) and 2 more genes

Synopsis

Field NameValues
NameD18S1162
AliasesA099ZD1; AFMA099ZD1; AFMa099zd1; HSA099ZD1; W5302
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Pan troglodytes; Homo sapiens
Target genesFHOD3 (Nomascus leucogenys); FHOD3 (Pan troglodytes); FHOD3 (Homo sapiens)

Sequences

>Probe|12498201|PRIMERF Forward PCR primer (outermost) (24b)
CAGCATTCTTACTGATACTCAGGA
>Probe|12498201|PRIMERR Reverse PCR primer (outermost) (17b)
GCAGCAGACCTGGCTTA

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

Show All 3 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map18 cmD18S1162
Homo sapienslinkageMarshfield1862.29 cmAFMa099zd1
Homo sapienslinkagedeCODE1857.77 cmD18S1162
Homo sapienslinkageGenethon1861.7 cmAFMa099zd1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID26093
Probe Cross-refcontext specific help for: Probe Cross-refGDB:614784
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk