Display Settings:

Format

Send to:

Choose Destination
Pr012497669

STS probe M238_M239 for ubiquitin specific peptidase 9, Y-linked (USP9Y) and 3 more genes

Synopsis

Field NameValues
NameM238_M239
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100130216; USP9Y; LOC465988; USP9Y
UniSTS IDUniSTS:260450

Sequences

>Probe|12497669|PRIMERF Forward PCR primer (outermost) (25b)
GTACTAAATGGCACATAATTAGGAA
>Probe|12497669|PRIMERR Reverse PCR primer (outermost) (26b)
AATTTAGAATGATTTTCAGTATCAGC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID260450
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk