Display Settings:

Format

Send to:

Choose Destination
Pr012496825

STS probe Col2a1 for collagen, type II, alpha 1 (Col2a1) and 13 more genes

Synopsis

Field NameValues
NameCol2a1
TypeSTS
Application
Source organism
Source sequence
Target genesCOL2A1; LOC100027887; COL2A1; COL2A1; COL2A1; COL2A1; COL2A1; Col2a1; Col2a1; Col2a1; Col2a1; COL2A1; COL2A1; COL2A1
UniSTS IDUniSTS:259692

Sequences

>Probe|12496825|PRIMERF Forward PCR primer (outermost) (21b)
GTGGAGCAGCAAGAGCAAGGA
>Probe|12496825|PRIMERR Reverse PCR primer (outermost) (21b)
CTTGCCCCACTTACCAGTGTG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk