Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012495250

STS probe Fgf8

Synopsis

Field NameValues
NameFgf8
TypeSTS
Application
Source organism
Source sequence

Sequences

>Probe|12495250|PRIMERF Forward PCR primer (outermost) (24b)
CTGAGCTGCCTGCTGTTGCACTTG
>Probe|12495250|PRIMERR Reverse PCR primer (outermost) (24b)
GGTAGTTGAGGAACTCGAAGCGCA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk