Display Settings:

Format

Send to:

Choose Destination
Pr012493783

STS probe UniSTS:256954 for v-myc avian myelocytomatosis viral oncogene homolog (MYC) and 15 more genes

Synopsis

Field NameValues
NameUniSTS:256954
AliasesMyc
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesMYC; MYC; MYC; MYC; MYC; MYC; Myc; LOC100773301; Myc; Myc; mycb; MYC; MYC; MYCMore
UniSTS IDUniSTS:256954

Sequences

>Probe|12493783|PRIMERF Forward PCR primer (outermost) (19b)
CGCGCCCAGTGAGGATATC
>Probe|12493783|PRIMERR Reverse PCR primer (outermost) (21b)
CCACATACAGTCCTGGATGAT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map8 cmUniSTS:256954

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk