Display Settings:

Format

Send to:

Choose Destination
Pr012493450

STS probe Apc for adenomatosis polyposis coli (Apc) and 1 more gene

Synopsis

Field NameValues
NameApc
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100048863; Apc
UniSTS IDUniSTS:256651

Sequences

>Probe|12493450|PRIMERF Forward PCR primer (outermost) (21b)
GAGCGGGTATACAGTCAGGTG
>Probe|12493450|PRIMERR Reverse PCR primer (outermost) (21b)
TCCTCTGCTTTGTTGTCATCC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:2654675
UniSTS IDcontext specific help for: UniSTS ID256651
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk