Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012493124

Mus musculus STS probe Naip1 for NLR family, apoptosis inhibitory protein 1 (Naip1)

Synopsis

Field NameValues
NameNaip1
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target geneNaip1 (Mus musculus)

Sequences

>Probe|12493124|PRIMERF Forward PCR primer (outermost) (25b)
GTGTAGCTTGATCCTCTTTGGCAAT
>Probe|12493124|PRIMERR Reverse PCR primer (outermost) (21b)
CATCTCCTTCTTCCCAGTTGG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:2451123
UniSTS IDcontext specific help for: UniSTS ID256358
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk