Display Settings:

Format

Send to:

Choose Destination
Pr012491370

Eukaryota (15 taxa) STS probe SHGC-16181 for O-linked N-acetylglucosamine (GlcNAc) transferase (OGT) and 14 more genes

Synopsis

Field NameValues
NameSHGC-16181
AliasesRH14259
TypeSTS
Application
Source organism
Source sequence
Target organismsRattus norvegicus; Cavia porcellus; Nomascus leucogenys; Callithrix jacchus; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens; Canis lupus familiaris; Ailuropoda melanoleuca; Loxodonta africana; Equus caballus; Sus scrofa; Bos taurusMore
Target genesOGT (Equus caballus); OGT (Pongo abelii); OGT (Oryctolagus cuniculus); OGT (Callithrix jacchus); OGT (Ailuropoda melanoleuca); OGT (Nomascus leucogenys); OGT (Loxodonta africana); Ogt (Cavia porcellus); Ogt (Rattus norvegicus); OGT (Pan troglodytes); OGT (Canis lupus familiaris); OGT (Bos taurus); OGT (Sus scrofa); OGT (Macaca mulatta)More
UniSTS IDUniSTS:25478

Sequences

>Probe|12491370|PRIMERF Forward PCR primer (outermost) (21b)
CAGAATAGGACTGAGGGAGCC
>Probe|12491370|PRIMERR Reverse PCR primer (outermost) (22b)
CATTCTGCTCTTCTGATGATGC

References

1.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-G3X2131 cr10000SHGC-16181
Homo sapienslinkageRutgers MapX cmSHGC-16181

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID25478
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5035056
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk