Display Settings:

Format

Send to:

Choose Destination
Pr012490793

Homo sapiens STS probe DXS7359

Synopsis

Field NameValues
NameDXS7359
AliasesHUMSWX2060; sWXD2060
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:25426

Sequences

>Probe|12490793|PRIMERF Forward PCR primer (outermost) (24b)
CAGAACTTCCTTCTTAATACAAAC
>Probe|12490793|PRIMERR Reverse PCR primer (outermost) (20b)
CTTTGGCAGCAAATATCCTC

References

1.

X chromosome map at 75-kb STS resolution, revealing extremes of recombination and GC content.

Nagaraja R, MacMillan S, Kere J, Jones C, Griffin S, Schmatz M, Terrell J, Shomaker M, Jermak C, Hott C, Masisi M, Mumm S, Srivastava A, Pilia G, Featherstone T, Mazzarella R, Kesterson S, McCauley B, Railey B, Burough F, Nowotny V, D'Urso M, States D, Brownstein B, Schlessinger D.

Genome Res. 1997 Mar;7(3):210-22.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmDXS7359
Homo sapiensphysicalWUSTL-XX7.05 ordinalsWXD2060

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID25426
Probe Cross-refcontext specific help for: Probe Cross-refGDB:556353
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk