Display Settings:

Format

Send to:

Choose Destination
Pr012490510

Sus scrofa and Bos taurus STS probe SCYA2 for chemokine (C-C motif) ligand 2 (CCL2) and 1 more gene

Synopsis

Field NameValues
NameSCYA2
TypeSTS
Application
Source organism
Source sequence
Target organismsSus scrofa; Bos taurus
Target genesCCL2 (Bos taurus); CCL2 (Sus scrofa)
UniSTS IDUniSTS:254004

Sequences

>Probe|12490510|PRIMERF Forward PCR primer (outermost) (20b)
CAGAAGAGTCACCAGCAGCA
>Probe|12490510|PRIMERR Reverse PCR primer (outermost) (20b)
AGGCTTCGGAGTTTGGTTTT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID254004
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk