Display Settings:

Format

Send to:

Choose Destination
Pr012490346

Sus scrofa STS probe TNFA-2 for tumor necrosis factor (TNF) and 1 more gene

Synopsis

Field NameValues
NameTNFA-2
TypeSTS
Application
Source organism
Source sequence
Target organismSus scrofa
Target genesMIC-2 (Sus scrofa); TNF (Sus scrofa)
UniSTS IDUniSTS:253858

Sequences

>Probe|12490346|PRIMERF Forward PCR primer (outermost) (22b)
TTTTTAGGCTTCCCTTTCTTCC
>Probe|12490346|PRIMERR Reverse PCR primer (outermost) (19b)
AACCAAGGCAGCCCTTATG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID253858
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk