Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012487864

Eukaryota (8 taxa) STS probe UniSTS:251621 for calpain 3, (p94) (CAPN3) and 8 more genes

Synopsis

Field NameValues
NameUniSTS:251621
AliasesSKM-CALPOV; CANP3; CANP3S4; CAPN3; CAPN3_S
TypeSTS
Application
Source organism
Source sequence
Target organismsMus musculus; Rattus norvegicus; Callithrix jacchus; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens; Bos taurus
Target genesCAPN3 (Callithrix jacchus); CAPN3 (Pongo abelii); Capn3 (Mus musculus); CAPN3 (Bos taurus); Capn3 (Rattus norvegicus); CAPN3 (Pan troglodytes); CAPN3 (Macaca mulatta); 4931402G19Rik (Mus musculus); CAPN3 (Homo sapiens)

Sequences

>Probe|12487864|PRIMERF Forward PCR primer (outermost) (24b)
GCTTCCTTTCCTTGAAGGTAGCTG
>Probe|12487864|PRIMERR Reverse PCR primer (outermost) (26b)
CTGCTCGAATGTCTTCTCTTTCACCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map15 cmUniSTS:251621

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID251621
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5503378
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk