Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012486951

Homo sapiens STS probe D20S109

Synopsis

Field NameValues
NameD20S109
Aliases165XH2; AFM165xh2; HS165XH2; RH15142; RH28240
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens

Sequences

>Probe|12486951|PRIMERF Forward PCR primer (outermost) (25b)
AACACACATACAAACACACGCAGAT
>Probe|12486951|PRIMERR Reverse PCR primer (outermost) (20b)
TTCCAGACAGGACAGCCTGC

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageMarshfield2074.47 cmAFM165xh2
Homo sapienslinkageGenethon2073.6 cmAFM165xh2

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:188154
UniSTS IDcontext specific help for: UniSTS ID2508
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk