Display Settings:

Format

Send to:

Choose Destination
Pr012483952

Homo sapiens STS probe AL031085

Synopsis

Field NameValues
NameAL031085
AliasesDJ321E8T7; stSG45901
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:2481

Sequences

>Probe|12483952|PRIMERF Forward PCR primer (outermost) (22b)
AACAATGGTTTGGAAGAAATGG
>Probe|12483952|PRIMERR Reverse PCR primer (outermost) (21b)
CTAGTCACCAAGGCTGACCTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmAL031085

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID2481
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk