Display Settings:

Format

Send to:

Choose Destination
Pr012481642

STS probe GDB:1317924 for B-Raf proto-oncogene, serine/threonine kinase (BRAF) and 2 more genes

Synopsis

Field NameValues
NameGDB:1317924
AliassWSS2196
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesBRAF; BRAF; BRAF
UniSTS IDUniSTS:24602

Sequences

>Probe|12481642|PRIMERF Forward PCR primer (outermost) (19b)
CACCCCTTTAGAAAATCAC
>Probe|12481642|PRIMERR Reverse PCR primer (outermost) (20b)
TATTTGCGTCACCAATACAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map7 cmGDB:1317924

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID24602
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center