Display Settings:

Format

Send to:

Choose Destination
Pr012476179

STS probe D7S1887 for similar to large subunit ribosomal protein L36a (LOC730669)

Synopsis

Field NameValues
NameD7S1887
AliasessWSS1193
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneLOC730669
UniSTS IDUniSTS:24110

Sequences

>Probe|12476179|PRIMERF Forward PCR primer (outermost) (20b)
CACAGATTTATTTCTACAGG
>Probe|12476179|PRIMERR Reverse PCR primer (outermost) (18b)
GAATATCGTTCAAGTAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map7 cmD7S1887

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID24110
Probe Cross-refcontext specific help for: Probe Cross-refGDB:333966
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk