Display Settings:

Format

Send to:

Choose Destination
Pr031798250

STS probe UniSTS:237371 for peroxisome proliferator activated receptor alpha (Ppara)

Synopsis

Field NameValues
NameUniSTS:237371
TypeSTS
Application
Source organism
Source sequence
Target genePpara
UniSTS IDUniSTS:237371

Sequences

>Probe|31798250|PRIMERF Forward PCR primer (outermost) (20b)
AAAGATGTCCCAGTGCCTTG
>Probe|31798250|PRIMERR Reverse PCR primer (outermost) (20b)
AACCAGGCTGTTTCGTTGTC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID237371
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk