Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012472829

Nomascus leucogenys STS probe L78117 for uncharacterized LOC100597081 (LOC100597081)

Synopsis

Field NameValues
NameL78117
AliasesHUMSWX2181; sWXD2181
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Homo sapiens
Target geneLOC100597081 (Nomascus leucogenys)

Sequences

>Probe|12472829|PRIMERF Forward PCR primer (outermost) (24b)
CAATTATATTTGGAGACAGTAACG
>Probe|12472829|PRIMERR Reverse PCR primer (outermost) (24b)
AGATTAGGACAAGTTGATTGATGG

References

1.

X chromosome map at 75-kb STS resolution, revealing extremes of recombination and GC content.

Nagaraja R, MacMillan S, Kere J, Jones C, Griffin S, Schmatz M, Terrell J, Shomaker M, Jermak C, Hott C, Masisi M, Mumm S, Srivastava A, Pilia G, Featherstone T, Mazzarella R, Kesterson S, McCauley B, Railey B, Burough F, Nowotny V, D'Urso M, States D, Brownstein B, Schlessinger D.

Genome Res. 1997 Mar;7(3):210-22.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmL78117
Homo sapiensphysicalWUSTL-XX7.4 ordinalsWXD2181

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID23672
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk