Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012471854

Eukaryota (6 taxa) STS probe A004M13 for JMJD7-PLA2G4B readthrough (JMJD7-PLA2G4B) and 19 more genes

Synopsis

Field NameValues
NameA004M13
AliasesRH25656
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens; Oryctolagus cuniculus
Target genesJMJD7 (Homo sapiens); JMJD7 (Oryctolagus cuniculus); MAPKBP1 (Pongo abelii); PLA2G4B (Pongo abelii); MAPKBP1 (Nomascus leucogenys); PLA2G4B (Nomascus leucogenys); MAPKBP1 (Homo sapiens); MAPKBP1 (Pan troglodytes); JMJD7 (Macaca mulatta); LOC735627 (Pan troglodytes); LOC735681 (Pan troglodytes); JMJD7 (Pan troglodytes); LOC740558 (Pan troglodytes); LOC740916 (Pan troglodytes); LOC741812 (Pan troglodytes); LOC748197 (Pan troglodytes); LOC748666 (Pan troglodytes); LOC749454 (Pan troglodytes); MAPKBP1 (Pan troglodytes); JMJD7-PLA2G4B (Homo sapiens)

Sequences

>Probe|12471854|PRIMERF Forward PCR primer (outermost) (22b)
CAAGTTCATACATCAGTACAAA
>Probe|12471854|PRIMERR Reverse PCR primer (outermost) (18b)
TGAAAGCCCCTTATTTAT

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB415148.43 cr3000A004M13
Homo sapienslinkageRutgers Map15 cmA004M13
Homo sapiensradiation hybridNCBI RH15127.2 crA004M13

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID23345
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk