Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012470888

Homo sapiens STS probe AL008929

Synopsis

Field NameValues
NameAL008929
AliasesDJ57A13T7B; stSG24604
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens

Sequences

>Probe|12470888|PRIMERF Forward PCR primer (outermost) (20b)
CAAGGTGCTAGAGACTGGCC
>Probe|12470888|PRIMERR Reverse PCR primer (outermost) (21b)
GAGGCCAAGATCCAGAGTAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmAL008929

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID23258
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk