Display Settings:

Format

Send to:

Choose Destination
Pr012470789

STS probe D7S2561 for tensin 3 (TNS3) and 1 more gene

Synopsis

Field NameValues
NameD7S2561
AliasesAFMa082wf5; sWSS2487
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100134045; TNS3
UniSTS IDUniSTS:23249

Sequences

>Probe|12470789|PRIMERF Forward PCR primer (outermost) (18b)
CAAGGTACGACAAAGAAC
>Probe|12470789|PRIMERR Reverse PCR primer (outermost) (20b)
AATATTATAGGCATGGACAG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:3754528
UniSTS IDcontext specific help for: UniSTS ID23249
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk