Display Settings:

Format

Send to:

Choose Destination
Pr012470158

Mus musculus and Rattus norvegicus STS probe RH142674 for chemokine (C-X-C motif) receptor 3 (Cxcr3) and 1 more gene

Synopsis

Field NameValues
NameRH142674
AliasesAI072601
TypeSTS
Application
Source organism
Source sequence
Target organismsMus musculus; Rattus norvegicus
Target genesCxcr3 (Mus musculus); Cxcr3 (Rattus norvegicus)
UniSTS IDUniSTS:231921

Sequences

>Probe|12470158|PRIMERF Forward PCR primer (outermost) (21b)
TCCCCATAATCGTAGGGAGAT
>Probe|12470158|PRIMERR Reverse PCR primer (outermost) (20b)
GCCAAGCCATGTACCTTGAG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk