Display Settings:

Format

Send to:

Choose Destination
Pr031779298

STS probe UniSTS:224312 for gamma-aminobutyric acid receptor associated protein (Gabarap) and 4 more genes

Synopsis

Field NameValues
NameUniSTS:224312
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100861682; Phf23; Gabarap; Gabarap; Phf23
UniSTS IDUniSTS:224312

Sequences

>Probe|31779298|PRIMERF Forward PCR primer (outermost) (20b)
GAACCCCAATAATCCCTTCC
>Probe|31779298|PRIMERR Reverse PCR primer (outermost) (20b)
AGCTCGGTGGTTTCCTTTTT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5507067
UniSTS IDcontext specific help for: UniSTS ID224312
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk