Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012457830

Homo sapiens STS probe SHGC-36691 for integrator complex subunit 10 (INTS10)

Synopsis

Field NameValues
NameSHGC-36691
AliasesRH38052
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneINTS10 (Homo sapiens)

Sequences

>Probe|12457830|PRIMERF Forward PCR primer (outermost) (25b)
CAAAACAGATTGGTACTTTTGTTTT
>Probe|12457830|PRIMERR Reverse PCR primer (outermost) (24b)
AAAACCATCCTGAGTTCTAACTCC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G38896 cr10000SHGC-36691
Homo sapiensradiation hybridGeneMap99-G38983 cr10000SHGC-36691
Homo sapienslinkageRutgers Map8 cmSHGC-36691

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID21971
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is temporarily unavailable.

Write to the Help Desk