Display Settings:

Format

Send to:

Choose Destination
Pr012457173

STS probe RH137029 for similar to nudix (nucleoside diphosphate linked moiety X)-type motif 21 (LOC623403) and 2 more genes

Synopsis

Field NameValues
NameRH137029
AliasAA955588
TypeSTS
Application
Source organism
Source sequence
Target organismRattus norvegicus
Target genesLOC623403; Gm7488; LOC670348
UniSTS IDUniSTS:219118

Sequences

>Probe|12457173|PRIMERF Forward PCR primer (outermost) (22b)
CTCTTCAAACAGGAAGGTGGTG
>Probe|12457173|PRIMERR Reverse PCR primer (outermost) (22b)
CGGACCCATCATTTCTAGTCTT

References

1.

High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.

Kwitek AE, Gullings-Handley J, Yu J, Carlos DC, Orlebeke K, Nie J, Eckert J, Lemke A, Andrae JW, Bromberg S, Pasko D, Chen D, Scheetz TE, Casavant TL, Soares MB, Sheffield VC, Tonellato PJ, Jacob HJ.

Genome Res. 2004 Apr;14(4):750-7.

2.

A high-density integrated genetic linkage and radiation hybrid map of the laboratory rat.

Steen RG, Kwitek-Black AE, Glenn C, Gullings-Handley J, Van Etten W, Atkinson OS, Appel D, Twigger S, Muir M, Mull T, Granados M, Kissebah M, Russo K, Crane R, Popp M, Peden M, Matise T, Brown DM, Lu J, Kingsmore S, Tonellato PJ, Rozen S, Slonim D, Young P, Jacob HJ.

Genome Res. 1999 Jun;9(6):AP1-8, insert. Genome Res 1999 Aug;9(8):793.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Rattus norvegicusradiation hybridMCW RH50 crAA955588

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk