Display Settings:

Format

Send to:

Choose Destination
Pr012455708

STS probe D17S1990 for DEAD-box helicase 5 (DDX5) and 15 more genes

Synopsis

Field NameValues
NameD17S1990
AliasesUTR-01311; WI-7618
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesDDX5; DDX5; DDX5; DDX5; DDX5; DDX5; Ddx5; Ddx5; Ddx5; DDX5; Ddx5; Polg2; DDX5; DDX5More
UniSTS IDUniSTS:2178

Sequences

>Probe|12455708|PRIMERF Forward PCR primer (outermost) (25b)
AAATGTCTGTTTTTCATAATTGCTC
>Probe|12455708|PRIMERR Reverse PCR primer (outermost) (24b)
TCAAATATTTTTTATTGGAAGGCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map17 cmD17S1990

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID2178
Probe Cross-refcontext specific help for: Probe Cross-refGDB:677593; RGD:5500839
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center