Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012455031

Eukaryota (3 taxa) STS probe STS-N35229 for biogenesis of lysosomal organelles complex-1, subunit 6, pallidin (BLOC1S6) and 2 more genes

Synopsis

Field NameValues
NameSTS-N35229
AliasesRH39532; sts-N35229
TypeSTS
Application
Source organism
Source sequence
Target organismsPan troglodytes; Pongo abelii; Homo sapiens
Target genesLOC100453875 (Pongo abelii); BLOC1S6 (Homo sapiens); SQRDL (Pan troglodytes)

Sequences

>Probe|12455031|PRIMERF Forward PCR primer (outermost) (20b)
ATTTGTGCCTTGTCATTTGT
>Probe|12455031|PRIMERR Reverse PCR primer (outermost) (22b)
GAGCTGCTGCTTTTGATATAGT

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB415157.08 cr3000sts-N35229
Homo sapienslinkageRutgers Map15 cmSTS-N35229
Homo sapiensradiation hybridNCBI RH15169.1 crsts-N35229

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID21719
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is temporarily unavailable.

Write to the Help Desk