Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012454420

Eukaryota (4 taxa) STS probe D2S328 for lipin 1 (LPIN1) and 3 more genes

Synopsis

Field NameValues
NameD2S328
Aliases268VA5; AFM268VA5; AFM268va5; HS268VA5
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Pan troglodytes; Homo sapiens
Target genesLPIN1 (Nomascus leucogenys); LPIN1 (Homo sapiens); LPIN1 (Pan troglodytes); LOC697682 (Macaca mulatta)

Sequences

>Probe|12454420|PRIMERF Forward PCR primer (outermost) (17b)
ATTTGCTTCATTCGCCC
>Probe|12454420|PRIMERR Reverse PCR primer (outermost) (22b)
AAATGGTATCTTAGCCAGAGAG

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmD2S328
Homo sapienslinkageMarshfield227.6 cmAFM268va5
Homo sapienslinkageGenethon229.2 cmAFM268va5

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID21664
Probe Cross-refcontext specific help for: Probe Cross-refGDB:199626
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk